Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: Using single-crossover homologous recombination we successfully integrated a control plasmid (pCAM-BSD HSP40 ctrl ) into the HSP40 (PF3D7_1437900) locus. Despite 7 months of continuous culture, integration of a disruption construct (pCAM-BSD HSP40 KO ) was not observed. (A) Genomic DNA isolated from blasticidin-resistant parasites transfected with pCAM-BSD HSP40 ctrl or pCAM-BSD HSP40 KO was subjected to PCR. Two sets of primers detect episomal plasmid in both cases (ctrl: 1081bp, 1133bp and KO: 902bp, 982bp). Integration events are detected by primers (∼1800bp). Integration of the control plasmid is present, while no integration of the KO plasmid is observed. Representative of three independent transfections. (B,C) Genomic DNA isolated from blasticidin-resistant parasites transfected with pCAM-BSD HSP40 ctrl or pCAM-BSD HSP40 KO was subjected to Southern blot analysis. (B) Plasmid and genomic DNA was digested with the restriction enzyme SmlI, transferred to membrane, and probed with a 719bp HSP40 control fragment. The control plasmid (pCAM-BSD HSP40 ctrl ) was successfully integrated into the HSP40 locus in four independent transfections (1-4). (C) Plasmid and genomic DNA was digested with the restriction enzyme HpaII, transferred to membrane, and probed with a 693bp HSP40 KO fragment. Integration of a disruption construct (pCAM-BSD HSP40 KO ) was not observed in two independent transfections (5,6) after 7 months of continuous culture.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Homologous Recombination, Plasmid Preparation, Construct, Isolation, Transfection, Southern Blot

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: ATPase activity of purified HSP70. (A) Recombinant HSP70 (73 kDa) and HSP40 (48 kDa) were purified from E. coli. Proteins are visualized on SDS gel with Coomassie blue stain (B) The ATPase activities of 45 μg of HSP70 was measured every 12 seconds for 40 minutes. HSP70 had increased ATPase activity in the presence of HSP40 (8.9 μg; green) than alone (blue). HSP40 (gray) and no protein (black) were used as controls, n=4. (C) The slopes of the lines in (B). (D) The rate of ATP turnover increases linearly with increased HSP70 concentration, n=2.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Activity Assay, Purification, Recombinant, SDS-Gel, Staining, Concentration Assay

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: (A) Pre-bleed antisera immunoblot of recombinant protein, RBC lysate, and wildtype P. falciparum lysate. (B) Anti-HSP40 immunoblot of recombinant protein, RBC lysate, and wildtype P. falciparum lysate. A single band is observed at 48 kDa in parasite lysate corresponding to the expected size of HSP40. (A,B) Pre-bleed and Anti-HSP40 were used at 1:5,000. (C) Spectral counts from Hsp40s identified by mass spectrometry after IP of parasite lysate with pre-bleed antisera or anti-HSP40. Fold change is the ratio of the average spectral counts between anti-HSP40 and pre-bleed. HSP40 is the only Hsp40 protein with a robust fold change and protein coverage.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Western Blot, Recombinant, Mass Spectrometry

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: (A) Immunofluorescence confocal microscopy of trophozoite, stained with anti-HSP40 (1:5,000) and Hoechst 33258 nuclear stain. HSP40 appears cytosolic. (B) Electron micrograph of Immunolabeling: primary, rabbit anti-HSP40 (1:250), mouse anti-PDI (1:100); secondary, goat anti-rabbit IgG 18nm colloidal gold, goat anti-mouse 12nm. HSP40 (orange arrowheads) looks cytosolic in the parasites, with some apparent membrane association. A portion of HSP40 co-localizes with PDI, an established ER marker (white arrowheads). Scale, 500 nm.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Immunofluorescence, Confocal Microscopy, Staining, Immunolabeling, Marker

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: Inhibition of either IPP synthesis or protein farnesylation results in reduced membrane-association of HSP40. (A,B) Representative anti-HSP40 immunoblots of control and FSM (20μM) treated (A) or FTI (10μM) treated (B) P. falciparum total lysate and membrane fractions. (C,D) Quantification of several immunoblots adjusted to loading control. HSP40 is significantly reduced in the membrane fraction after inhibition of IPP synthesis (C) and inhibition of farnesylation (D). Anti-HAD1 and Anti-Exp-2, loading controls for total lysate and membrane fractions, respectively. ** p≤0.01, *** p≤0.001 unpaired t-test with Welch’s correction. (E-H) HSP40 membrane association is reduced after FSM and FTI treatment. Apparent membrane-associated HSP40 (10nm gold particles, arrowheads) is reduced after inhibition of IPP synthesis and farnesylation. The number of membrane-associated HSP40 per micrograph is quantified for control and treated parasites (G,H). A single control cohort was quantified. A decrease in the number of membrane-associated HSP40 particles is observed. * p≤0.05, unpaired t-test with Welch’s correction. Scale, 500 nm.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Inhibition, Western Blot

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: (A) Representative anti-HSP40 immunoblots of control, BMS (200nM) and GGTI (2μM) treated P. falciparum total lysate and membrane fractions. (B) Quantification of several immunoblots adjusted with loading control. HSP40 is significantly reduced in the membrane fraction after inhibition of farnesylation (BMS) and not geranylgeranylation (GGTI). Anti-HAD1 and Anti-Exp-2, loading controls for total lysate and membrane fractions, respectively. ** p≤0.01, unpaired t-test with Welch’s correction.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Western Blot, Inhibition

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: Both farnesylation and palmitoylation contribute to HSP40 membrane-association, but only farnesylation is required for thermotolerance. (A) Representative anti-HSP40 immunoblots of control, FTI (10μM), 2BP (100μM), and combination of FTI- and 2BP-treated P. falciparum total lysate and membrane fractions. (B) Quantification of several immunoblots adjusted with loading control. The membrane-associated proportion of HSP40 is significantly reduced upon inhibition of farnesylation (FTI) or palmitoylation (2BP). Inhibition of both farnesylation and palmitoylation (FTI + 2BP) further reduces HSP40 membrane-association, as compared to single inhibitor treatment. Anti-HAD1 and Anti-Exp-2, loading controls for total lysate and membrane fractions, respectively. n = 3; * p≤0.05; ** p≤0.01; *** p≤0.001 unpaired t-test with Welch’s correction. (C-J) Parasites were treated with either FTI (10μM), 2BP (100μM), or both prior to heat (40°C) or cold (25°C) shock. FTI-treated parasite growth is significantly reduced after heat (D) and cold shock (H). Growth in 2BP-treated parasites is unchanged after heat or cold shock. (E,I). Parasites treated with both FTI and 2BP were sensitive to temperature stress (F,J). n = 3; * p≤0.05, ** p≤0.01; *** p≤0.001; **** p≤0.0001, 2-way ANOVA, p-values adjusted for multiple comparisons using Sidak’s multiple comparison test. Abbreviations: control (ctrl), heat shock (hs), cold shock (cs).

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Western Blot, Inhibition

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: (A) Gene ontology analysis reveals three significant HSP40-associated biological processes in asexual P. falciparum. All significant associations are lost in FSM-treated parasites. (B,C) The interactions of HSP40 with Tubulin α chain [Tub α; Q6ZLZ9], Tubulin chain [Tub β; Q7KQL5], Actin-1 [Act1; Q8I4X0], and GAPDH [Q8IKK7] are significantly reduced after inhibition of IPP synthesis and/or farnesylation. Interestingly, interactions with HSP70 [Q8IB24] are significantly increased after farnesylation inhibition, but not after inhibition of IPP synthesis. Protein-protein interactions were determined by mass spectrometry after IP of parasite lysate with anti-HSP40. Results for FSM (5μM)- and FTI (10μM)-treated parasites are compared to untreated controls. n = 3; multiple unpaired t-tests.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Inhibition, Mass Spectrometry

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: IPP-dependent HSP40 farnesylation promotes its interaction with Tubulin α chain (Tub α) Tubulin β chain (Tub β), Actin-1 (Act1), and GAPDH. ER-localized farnesyl-HSP40 likely mediates membrane trafficking in the early secretory pathway of the parasite, via direct interaction with these key client proteins.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques:

Journal: International Journal of Biological Sciences

Article Title: KLF4-Mediated CDH3 Upregulation Suppresses Human Hepatoma Cell Growth and Migration via GSK-3β Signaling

doi: 10.7150/ijbs.30857

Figure Lengend Snippet: Direct transcriptional activation of CDH3 by KLF4 in HCC cells. (A) The two potential binding sites for KLF4 in the promoter of CDH3. (B) CDH3 promoter reporters (pGL3-CDH3-627 and pGL3-CDH3-439) were transfected into 239T cells in triplicate with KLF4 expression plasmids or control vectors for 24 h. The CDH3 promoter activity was then examined using a dual luciferase assay kit. (C) The CDH3 promoter reporter activities were determined in KLF4 overexpressed Huh7 and Hep3B cells. (D) The CDH3 promoter reporter activities were determined in KLF4 silenced YY-8103 and HCC-LM3 cells. The experiments were performed independently three times. *P<0.05, **P<0.01. (E) Chromatin immunoprecipitation assays were performed with a specific anti-KLF4 antibody or IgG and oligonucleotides flanking the KLF4 binding sites were amplified by PCR. ( F ) The activities of mutant CDH3 promoters were determined by dual luciferase assays in KLF4 overexpressed Huh7 cells.

Article Snippet: Immunohistochemical analysis was performed with anti-KLF4 (1:200, Proteintech, 11880-1-AP) and anti-CDH3 antibody (1:50, Proteintech, 13773-1-AP).

Techniques: Activation Assay, Binding Assay, Transfection, Expressing, Control, Activity Assay, Luciferase, Chromatin Immunoprecipitation, Amplification, Mutagenesis

Journal: International Journal of Biological Sciences

Article Title: KLF4-Mediated CDH3 Upregulation Suppresses Human Hepatoma Cell Growth and Migration via GSK-3β Signaling

doi: 10.7150/ijbs.30857

Figure Lengend Snippet: CDH3 expression is activated by KLF4 in HCC cells. (A) KLF4 overexpression by transient transfection promoted CDH3 expression by qRT-PCR. (B) The mRNA level of CDH3 detected by qRT-PCR was reduced in KLF4 stably silenced HCC cells. *P<0.05, **P<0.01. (C) Overexpression of KFL4 enhanced CDH3 expression at protein level in WRL68 and YY-8103 cells detected by western blot analyses. (D) Western blots showing the expression pattern of KLF4 and CDH3 in a series of HCC cell lines.

Article Snippet: Immunohistochemical analysis was performed with anti-KLF4 (1:200, Proteintech, 11880-1-AP) and anti-CDH3 antibody (1:50, Proteintech, 13773-1-AP).

Techniques: Expressing, Over Expression, Transfection, Quantitative RT-PCR, Stable Transfection, Western Blot

Journal: International Journal of Biological Sciences

Article Title: KLF4-Mediated CDH3 Upregulation Suppresses Human Hepatoma Cell Growth and Migration via GSK-3β Signaling

doi: 10.7150/ijbs.30857

Figure Lengend Snippet: CDH3 expression is associated with KLF4 level in HCC specimens. (A) TMA specimens including 64 HCC tissues were prepared for immunostaining with specific antibodies against CDH3 and KLF4. Representative images of CDH3 and KLF4 expression in HCC specimens were shown. (B) Data showed that the CDH3 expression levels directly correlated with the KLF4 expression levels in HCC. (C) A positive correlation between KLF4 and CDH3 mRNA level in additional 37 paired HCC tissues was measured by linear regression (r=0.675, P<0.001).

Article Snippet: Immunohistochemical analysis was performed with anti-KLF4 (1:200, Proteintech, 11880-1-AP) and anti-CDH3 antibody (1:50, Proteintech, 13773-1-AP).

Techniques: Expressing, Immunostaining

Journal: International Journal of Biological Sciences

Article Title: KLF4-Mediated CDH3 Upregulation Suppresses Human Hepatoma Cell Growth and Migration via GSK-3β Signaling

doi: 10.7150/ijbs.30857

Figure Lengend Snippet: Downregulation of CDH3 induced cell proliferation and migration. (A) Colony formation assays were performed to detect the growth of LV-shCDH3-infected Focus, HCC-LM3 and WRL68 cells and control cells, respectively. Colonies were counted and captured. The levels of CDH3 expression were examined via western blot. *P<0.05. (B) Transwell assays were performed to detect changes in migratory abilities of Focus, HCC-LM3 and WRL68 cells treated with LV-shCDH3 or LV-shNC control. (C) KLF4 expression plasmid was transfected into CDH3 silenced HCC cells and control cells, respectively. Transwell chamber assays were then performed to detect cell migration of these cells.

Article Snippet: Immunohistochemical analysis was performed with anti-KLF4 (1:200, Proteintech, 11880-1-AP) and anti-CDH3 antibody (1:50, Proteintech, 13773-1-AP).

Techniques: Migration, Infection, Control, Expressing, Western Blot, Plasmid Preparation, Transfection

Journal: International Journal of Biological Sciences

Article Title: KLF4-Mediated CDH3 Upregulation Suppresses Human Hepatoma Cell Growth and Migration via GSK-3β Signaling

doi: 10.7150/ijbs.30857

Figure Lengend Snippet: The effect of CDH3 overexpression on growth and migration of HCC cells. (A) Cell proliferation of Huh7, YY-8103 and Sk-Hep-1 cells transfected with CDH3 plasmid or control empty vector was evaluated using CCK8 assay. And the level of CDH3 expression was examined using western blot. *P<0.05. (B) Transwell assays were conducted to evaluate migration of CDH3 overexpressed Huh7, YY-8103 and Sk-Hep-1 cells.

Article Snippet: Immunohistochemical analysis was performed with anti-KLF4 (1:200, Proteintech, 11880-1-AP) and anti-CDH3 antibody (1:50, Proteintech, 13773-1-AP).

Techniques: Over Expression, Migration, Transfection, Plasmid Preparation, Control, CCK-8 Assay, Expressing, Western Blot

Journal: International Journal of Biological Sciences

Article Title: KLF4-Mediated CDH3 Upregulation Suppresses Human Hepatoma Cell Growth and Migration via GSK-3β Signaling

doi: 10.7150/ijbs.30857

Figure Lengend Snippet: CDH3 affects GSK-3β expression in HCC cells. (A) Western blot analysis was used to measure the expressions of GSK-3β, p-GSK-3β, AKT, p-AKT, Erk, p-Erk, P70S6K, p-P70S6K, SMAD3, p-SMAD and β-catenin in CDH3 silenced Focus cells. (B) The levels of GSK-3β and p-GSK-3β were examined in CDH3 overexpressed YY8103 and HCC-LM3 cells using western blot assay. The cells were treated with or without insulin for 10 min. (C) TCF/LEF luciferase activity was measured by dual luciferase reporter kit and the results illustrated that CDH3 expression had no effect on the transcription activity of Wnt/β-catenin signaling. (D) The GSK-3β knockdown cell line was constructed by transfecting siGSK-3β into Focus and YY-8103 cells and detected by western blotting. (E) The migration assay was conducted in Focus and YY-8103 cells after transfection with siGSK-3β (or control).

Article Snippet: Immunohistochemical analysis was performed with anti-KLF4 (1:200, Proteintech, 11880-1-AP) and anti-CDH3 antibody (1:50, Proteintech, 13773-1-AP).

Techniques: Expressing, Western Blot, Luciferase, Activity Assay, Knockdown, Construct, Migration, Transfection, Control

Journal: Neuron

Article Title: The Epigenetic State of PRDM16-regulated Enhancers in Radial Glia Controls Cortical Neuron Position

doi: 10.1016/j.neuron.2018.04.033

Figure Lengend Snippet: RNA sequencing

Article Snippet: Forward: 5′-AAAAAGCAGTTGGCACAAGA-3′ Reverse: 5′-GGTCTATCATGGGCTGCACT-3′ This paper N/A Fluorescent in situ hybridization RNAscope probe Mm Pdzrn3 Advanced Cell Diagnostics Cat #517061 RNAscope probe Mm Itga6 Advanced Cell Diagnostics Cat #441701 RNAscope probe Mm Gabra2 Advanced Cell Diagnostics Cat #435011 RNAscope probe Mm Tubb3 Advanced Cell Diagnostics Cat #423391 Recombinant DNA pCAG-TAG Addgene Plasmid #26771 CAG-GFP-IRES-CRE Addgene Plasmid #48201 pCAGIG Addgene Plasmid #11159 pCMV-VSV-G Addgene Plasmid #8454 Hes5-Luc Addgene Plasmid #41724 pcDNA3.1 Prdm16 Addgene Plasmid #15503 pCAG- Prdm16 -IRES- GFP This paper N/A Hes5p- Prdm16 -IRES- GFP This paper N/A Hes5p- ΔPRdm16 -IRES- GFP This paper N/A pCAGIG Pdzrn3 This paper N/A Software and Algorithms ImageJ/ Fiji 1.49S Wayne Rasband National Institutes of Health, U.S.A. https://imagej.nih.gov/ij/ Imaris 7.0 Bitplane http://www.bitplane.com/releasenotes/imaris700.aspx Integrative Genomics Viewer (IGV) 2.3 Broad Institute MIT/Harvard http://software.broadinstitute.org/software/igv/ MATLAB R2017b MathWorks https://www.mathworks.com/products/matlab.html Cutadapt (Martin, 2011) http://code.google.com/p/cutadapt/ STAR (Dobin et al., 2013) http://code.google.com/p/rna-star/ FeatureCounts (Liao et al., 2014) http://subread.sourceforge.net DESeq2 (Love et al., 2014) http://www.bioconductor.org/packages/release/bioc/html/DESeq2.html gProfiler (Reimand et al., 2007) http://biit.cs.ut.ee/gprofiler/ REVIGO (Supek et al., 2011) http://revigo.irb.hr/ Bowtie2 2.2.8 (Langmead et al., 2009) http://bowtie.cbcb.umd.edu MACS2 2.1.1 (Zhang et al., 2008) https://pypi.python.org/pypi/MACS2 IDR R package (Li et al., 2011) http://cran.rproject.org/web/packages/idr/index.html HOMER v4.6 suite (Heinz et al., 2010) http://homer.ucsd.edu/homer/ DeepTools2 (Ramírez et al., 2016) deeptools.iefreiburg.mpg.de BETA v1.0.7 ( Wang et al., 2013 ) http://cistrome.org/BETA/ Open in a separate window RNA sequencing Chromatin immunoprecipitation and sequencing Approximately 20–40 million cortical cells were dual crosslinked by incubating in 1.5 mM EGS (ethylene glycol bis[succinimidyl succinate]) solution (Thermo Scientific) for 20 min at RT with rotation and then 1% PFA plus 1.5 mM EGS for an additional 10 min at RT.

Techniques: Virus, Recombinant, Blocking Assay, Nucleic Acid Hybridization, Isolation, Imaging, In Situ Hybridization, shRNA, Control, Real-time Polymerase Chain Reaction, RNAscope, Plasmid Preparation, Software

Journal: eLife

Article Title: Activation of the dopaminergic pathway from VTA to the medial olfactory tubercle generates odor-preference and reward

doi: 10.7554/eLife.25423

Figure Lengend Snippet: ( A ) Schematic of the fiber photometry setup for recording of the VTA-mOT DAergic projection from DAT-Cre mice. ( B ) Raw traces of GCaMP and control GFP fluorescence as the mice lick sucrose solution. ΔF/F represents change in fluorescence from the mean level before task. ( C ) The heatmap illustrated Ca 2+ signal responses of eight sucrose licking bouts from a representative mouse. Color bar: ΔF/F. ( D ) Responses to sucrose solution (left), food pellets (middle) and social interaction (right) for the control and GCaMP6m-expressing mice. *p<0.05. 10.7554/eLife.25423.007 Figure 2—source data 1. Fiber photometry recording ΔF/F value to sucrose solution, food pellets and social interaction for the control and GCaMP6m-expressing mice.

Article Snippet: AAV9-EF1a-DIO-GCaMP6m and AAV9-EF1a-DIO-EmGFP were gifts from Minmin Luo and constructed by replacing the coding region of ChR2-mCherry in the AAV9-EF1a-DIO-hChR2(H134R)-mCherry plasmid (constructed by K. Deisseroth) with those encoding enhanced membrane GFP (Addgene Plasmid 14757) or GCaMP6m (Addgene Plasmid 40754), respectively.

Techniques: Control, Fluorescence, Expressing

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) Relative tbc-7 mRNA levels measured by quantitative real-time PCR in L4 larvae. Data normalized to values for wild-type worms. Two independent reference genes ( pmp-3 and cdc-42 ) were used. Error bars show standard error of the mean (SEM) obtained from n = 3 biological replicates and three technical replicates each. **p<0.001, *p<0.005 (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( B ) Survival of wild-type and mir-1(gk276) animals (incubated on control (L4440) or tbc-7 RNAi bacteria) after exposure to 4 hr of heat stress (35°C) (n = 30). ***p<0.001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( C ) Predicted mir-1 binding site on the 3′UTR of tbc-7 mRNA (green) and seed sequence in mir-1 (blue). Mutated nucleotides in the tbc-7 3′UTR for experiments ( E–F ) are in red. ( D ) Indicated DNA constructs were co-transformed as multi-copy extrachromosomal arrays for experiments in ( E–F ). ( E ) Expression of heterologous reporter transgenes for control unc-54 3′UTR ( gfp ) and wild-type and mutated tbc-7 3′UTR ( mCherry ) constructs in body wall muscle. ( F ) Quantification of gfp and mCherry fluorescence of transgenic animals calculated as CTF/total area of fluorophore (n = 30). ****p<0.0001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( G ) WB of TBC1D15 and α-tubulin and ( H ) quantified bands from HeLa cells transfected with scrambled (Scr) or miR-1 mimics (n = 5). Data are mean fluorescence intensities ± SEM. **p<0.01 (Students t-test). ( I ) Predicted miR-1 binding site on the 3′UTR of TBC1D15 mRNA (green) and seed sequence in miR-1 (blue). Mutated nucleotides in the TBC1D15 3′UTR for experiments ( L–M ) are in red. ( J–K ) Quantification of flow cytometry analysis of HeLa cells co-expressing scrambled (Scr) or miR-1 mimic together with ( J ) GFPd2-3′UTR TBC1D15 (n = 4) or ( K ) mutated GFPd2-3′UTR TBC1D15 mutant (n = 5). Data are mean fluorescence intensities ± SEM, **p<0.01 (Students t-test).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Real-time Polymerase Chain Reaction, Comparison, Incubation, Control, Bacteria, Binding Assay, Sequencing, Construct, Transformation Assay, Expressing, Fluorescence, Transgenic Assay, Transfection, Flow Cytometry, Mutagenesis

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: Predicted mir-1 binding sites are found in the 3′UTRs of mRNAs that encode TBC proteins in C. elegans ( tbc-7 ), D. melanogaster (Skywalker) and humans (TBC1D15). This conservation is found in all vertebrate species examined (Targetscan). The mir-1 seed sequences are shown in blue and the predicted tbc-7 -related 3′UTRs are shown in green.

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Binding Assay

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) Relative TBC1D15 mRNA levels normalized to GAPDH measured by qRT-PCR from HeLa cells expressing scrambled miRNA or miR-1 mimic. Bar graph show fold changes compared to scrambled control ± SEM (n = 3). ( B–C ) Representative fluorescence intensity histograms from flow cytometry analysis of HeLa cells expressing scrambled miRNA (Scr) or miR-1 mimic together with ( B ) GFPd2-3′UTR-TBC1D15 or ( C ) GFPd2-3’UTR-TBC1D15 containing mutated miR-1 target sequence. Quantification of these histogram data is shown in . Wild-type hsa TBC1D15 3’UTR = 5′- CUUUCCUUUUCGAUAACAUUCCU -3′ and mutated hsa TBC1D15 3’UTR = 5′- CUUUCCUUUUCGAUAAAAUUACU -3′.

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Quantitative RT-PCR, Expressing, Control, Fluorescence, Flow Cytometry, Sequencing

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) WB and ( B ) quantification of LC3-II normalised to α-tubulin from HeLa cells expressing Scr or miR-1 mimics +/- bafilomycin. Data are mean fluorescence intensities of bands ± SEM (n = 3–5). **p<0.01, ***p<0.001 (one-way ANOVA with Dunnett’s correction). ( C ) WB and ( D ) quantification of LC3-II normalised to α-tubulin from HeLa cells expressing empty vector (control) or TBC1D15 overexpression vector +/- bafilomycin. Data are mean fluorescence intensities of bands ± SEM normalised to α-tubulin (n = 5). n.s. not significant to the control, ***p<0.001 (two-way ANOVA with Bonferroni correction). ( E ) IF images of HeLa cells stably expressing mRFP-GFP-LC3 and transfected with empty vector (control) or TBC1D15 overexpression vector. Scale bar, 10 μm. ( F ) Quantification of green and red vesicles and ( G ) red/green vesicle ratio from ( E ) ± SEM (n = 3, 12–14 cells per replicate). **p<0.01, ***p<0.001 (Student’s t-test). ( H ) WB and ( I ) quantification of HeLa cells co-transfected with Scr or miR-1 mimic together with empty vector or TBC1D15 overexpression vector +/- bafilomycin. Data are mean fluorescence intensities of LC3-II bands normalized to α-tubulin ± SEM (n = 7). **p<0.01, ***p<0.001 (two-way ANOVA with Bonferroni correction).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Expressing, Fluorescence, Plasmid Preparation, Control, Over Expression, Stable Transfection, Transfection

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) Quantification of the mean number of LC3-positive vesicles per HeLa cell ± SEM expressing scrambled miRNA (Scr) or independent miR-1 mimics immunostained with antibodies against LC3 (n = 3). *p<0.05, **p<0.01 (one-way ANOVA with Dunnett’s correction). ( B ) WB of HeLa cells transfected with Scr siRNA or siRNA against TBC1D15 in the presence or absence of bafilomycin (400 nM for 4 hr). ( C ) Mean fluorescence intensities of LC3-II WB bands ± SEM normalized to α-tubulin (n = 4). *p<0.05, **p<0.01 (Student’s t-test).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Expressing, Transfection, Fluorescence

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) Quantification of the percentage of cells containing HTT-positive aggregates co-expressing scrambled (Scr) or miR-1 mimics with EGFP-HTT Q74 for 48 hr ± SEM (n = 3, 200–400 cells per replicate). ***p<0.001 (one-way ANOVA). ( B ) CRISPR/Cas9 ATG16L1 knockout HeLa cells co-expressing scrambled (Scr) or miR-1 mimics with EGFP-HTT Q74 for 48 hr. Quantification of the percentage of cells containing HTT-positive aggregates ± SEM (n = 3, 200–400 cells per replicate). *p<0.05 (Student’s t-test), n.s. not significant (one-way ANOVA). ( C–E ) Quantification of the percentage of cells containing HTT-positive aggregates in HeLa cells co-expressing EGFP-HTT Q74 with ( C ) scrambled (Scr) or siRNA against TBC1D15 for 48 hr (n = 4, 200–400 cells per replicate), ( D ) empty or TBC1D15 overexpression vector for 24 hr (n = 3, 200–400 cells per replicate), or ( E ) a combination of Scr or miR-1 mimic together with empty or TBC1D15 overexpression vector for 48 hr (n = 6, 200–400 cells per replicate) ± SEM. ( C–D ) *p<0.05, **p<0.005, n.s. not significant (Student’s t-test) or ( E ) (two-way ANOVA with Dunnett’s correction).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Expressing, CRISPR, Knock-Out, Over Expression, Plasmid Preparation

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) WB and ( B ) quantification of Tbc1d15 normalized to α-tubulin of cortical neurons from mice treated with recombinant mouse IFN-β (100 U/ml) for 1–24 hr (n = 4). Data are mean fluorescence intensities of bands ± SEM. n.s. not significant to the control, *p < 0.05, **p < 0.01, ***p < 0.001 (one-way ANOVA). ( C ) RT-PCR of miR-1a-3p normalized to miR-191 from mouse cortical neurons treated with recombinant mouse IFN-β (100 U/ml) for 24 hr (n = 3). **p < 0.01 (Student’s t-test). ( D–E ) Flow cytometry analysis of HeLa cells expressing ( D ) GFPd2-3′UTR TBC1D15 (n = 4) or ( E ) mutated GFPd2-3′UTR TBC1D15 mutant (n = 5) treated with recombinant human IFN-β (1000 U/ml) for 6 or 24 hr. Data are presented as fluorescence intensity histograms and bar graphs showing mean fluorescence intensities ± SEM. *p<0.05, ***p<0.0001 (one-way ANOVA). ( F ) Quantification of HTT Q74 aggregates in HeLa cells expressing EGFP-HTT Q74 treated with recombinant human IFN-β (1000 U/ml) for 24 hr. Graph shows percentage of cells containing EGFP-HTT Q74 -positive aggregates (n = 4, 400 cells per replicate) ± SEM. **p<0.01 (Student’s t-test). ( G ) Quantification of HTT Q74 aggregates in HeLa cells expressing GFP-Off-control or GFP-Off-miR-1 (miR-1 hairpin inhibitor) with EGFP-HTT Q74 and treated with recombinant human IFN-β (1000 U/ml) for 48 hr. Graph represents percentage of cells containing EGFP-HTT Q74 -positive aggregates (n = 5, 400 cells per replicate) ± SEM. ***p<0.001, ****p<0.0001 (two-way ANOVA with Bonferroni correction). ( H ) WB of LC3, GFP and α-tubulin and ( I ) quantification of LC3-II normalized to α-tubulin from HeLa cells stably expressing GFP-Off-Control and GFP-Off-miR-1 treated with recombinant human IFN-β (1000 U/ml) for 6 hr, bafilomycin (400 mM) for 4 hr or in combination (n = 4) ± SEM. *p<0.05, **p<0.01, n.s. not significant (Student’s t-test).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Recombinant, Fluorescence, Control, Reverse Transcription Polymerase Chain Reaction, Flow Cytometry, Expressing, Mutagenesis, Stable Transfection

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) WB and ( B ) quantification of Tbc1d15 (normalized to vinculin) in the brain of wild-type ( Ifnb +/+ ) and Ifnb –/– 3 month old male mice (n = 4). Data are mean fluorescence intensities of bands ± SEM. **p < 0.01 (Student’s t-test).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Fluorescence

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) RT-PCR of miR-1–3 p normalized to miR-191 from HeLa cells treated with recombinant human IFN-β (1000 U/ml) for 6 hr (n = 3). **p < 0.01 (Student’s t-test). ( B ) WB and ( C ) quantification of TBC1D15 bands normalised to vinculin from HeLa cells treated with recombinant human IFN-β for 6 or 24 hr (n = 4). Data are mean fluorescence intensities ± SEM. *p < 0.05, **p < 0.01 (one-way ANOVA).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Reverse Transcription Polymerase Chain Reaction, Recombinant, Fluorescence

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) WB of TBC1D15, LC3 and α-tubulin in HeLa cells expressing empty or TBC1D15 overexpression vector, treated with recombinant human IFN-β (1000 U/ml) for 6 hr, bafilomycin (400 mM) for 4 hr, or a combination of both. ( B ) Quantification of mean fluorescence intensities of LC3-II bands from ( A ) (n = 4) ± SEM. *p < 0.05, **p < 0.01 ***p < 0.001 (Student’s t-test). ( C ) HeLa cells co-expressing EGFP-HTT Q74 with either empty or TBC1D15 overexpression vector with or without recombinant human IFN-β treatment (1000 U/ml) for 24 hr. Graph represents percentage of cells containing EGFP-HTT Q74 -positive aggregates ± SEM. *p < 0.05, **p < 0.01 ***p < 0.001 (Student’s t-test). ( D ) Neuronally differentiated N2A cells with non-targeting control-1 (NTC1) or Ifnb CRISPR/Cas9 knockout co-expressing EGFP-HTT Q74 . Graph represents percentage of cells containing EGFP-HTT Q74 -positive aggregates (n = 3) ± SEM. *p<0.01, **p<0.001 (Student’s t-test).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Expressing, Over Expression, Plasmid Preparation, Recombinant, Fluorescence, Control, CRISPR, Knock-Out

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) WB and quantification of LC3-II from HeLa cells transfected with scrambled siRNA or siRNA against Rab7 (Rab7Δ) +/- bafilomycin (4 hr, 400 nM). Data are mean fluorescence intensities of bands ± SEM normalised to α-tubulin (n = 3). *p<0.05, ***p<0.001 (two-way ANOVA). ( B ) WB and quantification of LC3-II normalised to α-tubulin from HeLa cells co-expressing pcDNA3.1 and EGFP, or TBC1D15 with either EGFP, pIRESneo-myc--Rab7 wt , EGFP-Rab7 Q67L , or EGFP-Rab7 T22N for 24 hr before treatment with bafilomycin (4 hr, 400 nM). Data are mean fluorescence intensities of bands ± SEM normalised to α-tubulin (n = 6). *p<0.05, **p<0.01, ***p<0.001 (two-way ANOVA). ( C ) Immunofluorescence (IF) images of HeLa cells co-expressing TBC1D15 with pIRESneo-myc-Rab7 wt , EGFP-Rab7 Q67L or EGFP-Rab7 T22N stained with antibodies against LC3 and TBC1D15. Scale bars, 10 μm. ( D ) WB showing immunoprecipitation (IP) of GTP-bound (active) Rab7 from HeLa expressing pcDNA3.1 or TBC1D15. Data are mean fluorescence intensities of GTP-bound Rab7 (IP) normalized to the endogenous level of Rab7 (cell lysate) ± SEM (n = 3). **p<0.01 (Student’s t-test). (E)IF of HeLa cells expressing empty vector or TBC1D15 stained with antibodies against GTP-bound Rab7, TBC1D15 and DAPI. Scale bar, 10 μm.

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Transfection, Fluorescence, Expressing, Immunofluorescence, Staining, Immunoprecipitation, Plasmid Preparation